l. acidophilus Search Results


90
NCIMB Ltd l. acidophilus ncimb 701748
L. Acidophilus Ncimb 701748, supplied by NCIMB Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/l%2E+acidophilus/l++acidophilus+ncimb+701748/10__7324_slash_jabb__2017__50409-255-20-22
Average 90 stars, based on 1 article reviews
l. acidophilus ncimb 701748 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Nestec Ltd bifidobacterium longum ncc 2705
Bifidobacterium Longum Ncc 2705, supplied by Nestec Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/l%2E+acidophilus/l++acidophilus+ncc2628/pmc10269482-231-4-12
Average 90 stars, based on 1 article reviews
bifidobacterium longum ncc 2705 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
PUMC Pharmaceutical Co Ltd heat-killed strain lactobacillus acidophilus ( l. acidophilus ) from human origin lactéol strain
Heat Killed Strain Lactobacillus Acidophilus ( L. Acidophilus ) From Human Origin Lactéol Strain, supplied by PUMC Pharmaceutical Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/l%2E+acidophilus/heat+killed+strain+lactobacillus+acidophilus+++l++acidophilus+++from+human+origin+lact%C3%A9ol+strain/pmc05112426-14-13-34
Average 90 stars, based on 1 article reviews
heat-killed strain lactobacillus acidophilus ( l. acidophilus ) from human origin lactéol strain - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Nebraska Cultures Inc l. acidophilus ncrm
L. Acidophilus Ncrm, supplied by Nebraska Cultures Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/l%2E+acidophilus/l++acidophilus+ncrm/us09717618-369-6-16
Average 90 stars, based on 1 article reviews
l. acidophilus ncrm - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
DaVinci Biosciences l. acidophilus modified release probiotic formula
L. Acidophilus Modified Release Probiotic Formula, supplied by DaVinci Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/l%2E+acidophilus/l++acidophilus+modified+release+probiotic+formula/pmc06683043__nutrients___11___01482___s001-14-9-20
Average 90 stars, based on 1 article reviews
l. acidophilus modified release probiotic formula - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
NCIMB Ltd l. acidophilus asf360
L. Acidophilus Asf360, supplied by NCIMB Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/l%2E+acidophilus/l++acidophilus+asf360/pmc03198401-50-22-37
Average 90 stars, based on 1 article reviews
l. acidophilus asf360 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Seroyal International Inc l. acidophilus (cul-60)
L. Acidophilus (Cul 60), supplied by Seroyal International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/l%2E+acidophilus/l++acidophilus++cul+60+/pmc06684237-48-14-3
Average 90 stars, based on 1 article reviews
l. acidophilus (cul-60) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Kibow Biotech biotics probiotic formulation l. acidophilus kb27
Diet treatments for the control of UTs.
Biotics Probiotic Formulation L. Acidophilus Kb27, supplied by Kibow Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/l%2E+acidophilus/biotics+probiotic+formulation+l++acidophilus+kb27/pmc08402511-183-7-6
Average 90 stars, based on 1 article reviews
biotics probiotic formulation l. acidophilus kb27 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
NCIMB Ltd l. acidophilus deposited under accession number ncimb 41117
Diet treatments for the control of UTs.
L. Acidophilus Deposited Under Accession Number Ncimb 41117, supplied by NCIMB Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/l%2E+acidophilus/l++acidophilus+deposited+under+accession+number+ncimb+41117/us07700141-59-4-10
Average 90 stars, based on 1 article reviews
l. acidophilus deposited under accession number ncimb 41117 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Metagenics Inc l acidophilus ncfb 1748
Fatigue Syndromes
L Acidophilus Ncfb 1748, supplied by Metagenics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/l%2E+acidophilus/l+acidophilus+ncfb+1748/pmc05312743-87-7-5
Average 90 stars, based on 1 article reviews
l acidophilus ncfb 1748 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
China Center for Type Culture Collection l. acidophilus
Oligonucleotide primers used in this study.
L. Acidophilus, supplied by China Center for Type Culture Collection, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/l%2E+acidophilus/l++acidophilus/pmc05454770-4-6-8
Average 90 stars, based on 1 article reviews
l. acidophilus - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
NCIMB Ltd lactobacillus acidophilus cul
Oligonucleotide primers used in this study.
Lactobacillus Acidophilus Cul, supplied by NCIMB Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/l%2E+acidophilus/l++acidophilus+cul+60+30157/10__1271_slash_kagakutoseibutsu__46__17-18-0-48
Average 90 stars, based on 1 article reviews
lactobacillus acidophilus cul - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Diet treatments for the control of UTs.

Journal: Toxins

Article Title: The Therapeutic Strategies for Uremic Toxins Control in Chronic Kidney Disease

doi: 10.3390/toxins13080573

Figure Lengend Snippet: Diet treatments for the control of UTs.

Article Snippet: In an RCT, the administration of Kibow Biotics probiotic formulation ( L. acidophilus KB27, B. longum KB31, and S. thermophilus KB19) in patients with CKD reduced BUN, Scr, and UA levels; enhanced patients’ quality of life; and resulted in no adverse effects [ ].

Techniques: Modification

Fatigue Syndromes

Journal: Integrative Medicine: A Clinician's Journal

Article Title: Probiotics and Disease: A Comprehensive Summary—Part 3, Cardiometabolic Disease and Fatigue Syndromes

doi:

Figure Lengend Snippet: Fatigue Syndromes

Article Snippet: Fatigue syndrome , Ultraflora Balance (Metagenics) , L acidophilus NCFB 1748.

Techniques: Transformation Assay, Animal Model, Isolation, Permeability, Activation Assay

Supplemental Information on Cardiometabolic Diseases and Fatigue Syndromes

Journal: Integrative Medicine: A Clinician's Journal

Article Title: Probiotics and Disease: A Comprehensive Summary—Part 3, Cardiometabolic Disease and Fatigue Syndromes

doi:

Figure Lengend Snippet: Supplemental Information on Cardiometabolic Diseases and Fatigue Syndromes

Article Snippet: Fatigue syndrome , Ultraflora Balance (Metagenics) , L acidophilus NCFB 1748.

Techniques: Isolation, Cell Culture, Derivative Assay

Oligonucleotide primers used in this study.

Journal: Frontiers in Microbiology

Article Title: Characterization of Feruloyl Esterases Produced by the Four Lactobacillus Species: L. amylovorus , L. acidophilus , L. farciminis and L. fermentum , Isolated from Ensiled Corn Stover

doi: 10.3389/fmicb.2017.00941

Figure Lengend Snippet: Oligonucleotide primers used in this study.

Article Snippet: P3 , GATAAAATTAATCTTTCCAAT , , , L. acidophilus CCTCC AB2010208.

Techniques: Sequencing, Plasmid Preparation

Plate screening assay showing FAE activities by clear zones around the individual colonies. The plates were incubated at 37°C for 72 h. 1 is an L. amylovorus CGMCC 11056 colony. 2 is an L. acidophilus CCTCC AB2010208 colony. 3 is an L. farciminis CCTCC AB2016237 colony. 4 is an L. fermentum CCTCC AB2010204 colony.

Journal: Frontiers in Microbiology

Article Title: Characterization of Feruloyl Esterases Produced by the Four Lactobacillus Species: L. amylovorus , L. acidophilus , L. farciminis and L. fermentum , Isolated from Ensiled Corn Stover

doi: 10.3389/fmicb.2017.00941

Figure Lengend Snippet: Plate screening assay showing FAE activities by clear zones around the individual colonies. The plates were incubated at 37°C for 72 h. 1 is an L. amylovorus CGMCC 11056 colony. 2 is an L. acidophilus CCTCC AB2010208 colony. 3 is an L. farciminis CCTCC AB2016237 colony. 4 is an L. fermentum CCTCC AB2010204 colony.

Article Snippet: P3 , GATAAAATTAATCTTTCCAAT , , , L. acidophilus CCTCC AB2010208.

Techniques: Screening Assay, Incubation